Pip5k1a molecular weight
Webb24 apr. 2024 · The TP53 gene, which encodes the p53 protein (which has a molecular weight of 53 kDa), is a famous tumor suppressor gene [15,16]. TP53 mutations occur in … WebbPIP5K1A antibody (ABIN6264231). Validated for IHC, WB. Tested in Human, Mouse, Rat. Order online. English +1 877 302 8632; Contact; Login Comparison List Basket Phone: +1 877 302 8632 Fax: +1 888 205 9894 (Toll-free) E …
Pip5k1a molecular weight
Did you know?
WebbPIP5K1A fusion protein Ag8355: Full Name: phosphatidylinositol-4-phosphate 5-kinase, type I, alpha: Calculated molecular weight: 56 kDa, 63 kDa: Observed molecular weight: … Webb1 mars 2024 · We observed a slight reduction in body weight in the 4-month-old cKO mice relative to control littermates (Fig. 2 A).While at this time the lengths of femurs were not significantly different between the two genotypes (Fig. 2, B and C), results from H/E staining of tibial sections revealed markedly reduced trabecular bone mass in cKO mice …
WebbFibrils were generated by incubating 40 μM K18 P301L protein with 40 μM low-molecular-weight heparin and 2 mM DTT in 100 mM sodium acetate at 37 °C. ... Pip5k1a: TRCN0000271151: TCGTACTTTGCTGCCCAAATT: Pip5k1b: TRCN0000024585: CGGGCTATTACATGAATTTAA: Pip5k1c: TRCN0000378595: … Webb3 juli 2024 · Anne Marie Helmenstine, Ph.D. Updated on July 03, 2024. Molecular weight is a measure of the sum of the atomic weight values of the atoms in a molecule. Molecular weight is used in chemistry to determine stoichiometry in chemical reactions and equations. Molecular weight is commonly abbreviated by M.W. or MW. Molecular weight …
WebbPolyclonal Antibody for studying PIP5K1A. Cited in 12 publications. Validated for Western Blotting. Highly specific and rigorously validated in-house, PIP5K1A Antibody (CST #9693) is ready to ship. WebbFunctional Associations. PIP5K1A has 4,555 functional associations with biological entities spanning 8 categories (molecular profile, organism, functional term, phrase or reference, chemical, disease, phenotype or trait, structural feature, cell line, cell type or tissue, gene, protein or microRNA) extracted from 81 datasets.
WebbPIP5K1A, phosphatidylinositol-4-phosphate 5-kinase type 1 alpha Vertebrate Orthologs 4 Vertebrate Orthology Source. Alliance of Genome ... Molecular Reagents less. All nucleic 83. cDNA 81. Primer pair 1. Other 1. Microarray probesets 6. Other Accession IDs less. MGD-MRK-36509 References more. Summaries.
http://www.biodragon.cn/plus/pdf.php?aid=96382 sandy buie party affiliationWebbMolecular Weight :86 kDa Gene Aliases : RP11-68I18.9 Scientific Background : PIP5K1A or phosphatidylinositol-4-phosphate 5-kinase 1 alpha phosphorylates phosphatidylinositol … short break in edinburghWebbPIP5K1A Catalyzes the phosphorylation of phosphatidylinositol 4-phosphate (PtdIns4P) to form phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). PtdIns(4,5) ... Molecular weight: 60,485 Da Basal Isoelectric point: 8.74 ... sandy bud ricksWebb9 juli 2014 · Total Structure Weight: 44.87 kDa Atom Count: 2,290 Modelled Residue Count: 303 Deposited Residue Count: 394 Unique protein chains: 1 Display Files Download Files … sandy buie voter registrationWebbFor Enjoyable Protein Research NovoPro +86-21-61941042 86-216-194-1042 [email protected]. Room 229, Building 26, No. 1333 Xinlong Road, Minhang District, Shanghai, China, Zip-code: 201101 sandy buie county court judgeWebb25 okt. 2005 · Function. Catalyzes the phosphorylation of phosphatidylinositol 4-phosphate (PtdIns 4 P/PI4P) to form phosphatidylinositol 4,5-bisphosphate (PtdIns (4,5)P2/PIP2), a lipid second messenger that regulates several cellular processes such as signal transduction, vesicle trafficking, actin cytoskeleton dynamics, cell adhesion, and cell … short break in istanbulWebb20 feb. 2007 · Poly(A) polymerase that creates the 3'-poly(A) tail of specific pre-mRNAs (PubMed:18288197, PubMed:21102410). Localizes to nuclear speckles together with PIP5K1A and mediates polyadenylation of a select set of mRNAs, such as HMOX1 (PubMed:18288197). In addition to polyadenylation, it is also required for the 3'-end … short break in dublin